Login:   Password:
Not Register?    Sign Up NOW!
Date: 21 November 2009
Google
 
Enhancing activity and controlling stereoselectivity in adesigned PLP-dependent aldolase  
Topic Name: Enhancing activity and controlling stereoselectivity in adesigned PLP-dependent aldolase
SocialTwist Tell-a-Friend

Category: Organic electronics

Research persons: Miguel D. Toscano, Manuel M. Müller and Donald Hilvert

Location: ETH Hönggerberg, HC,CH-8093 Zürich, I, Switzerland

Details

Enhancing activity and controlling stereoselectivity in adesigned PLP-dependent aldolase

Chemicals were purchased from Sigma, Acros, Aldrich or Fluka unless noted otherwise and used without further purification. Oligonucleotides were custom-synthesized and purified by Microsynth. Polymerase chain reactions (PCRs) were performed using cloned Pfu polymerase (Stratagene). Restriction endonucleases and T4 DNA ligase were purchased from New England Biolabs. All PCR-amplified genes of the constructed plasmids were confirmed by DNA sequencing on an Applied Biosystems PRISM 310 Automated DNA Sequencer using the Terminator Ready Reaction Mix (BigDyeTM, PE Applied Biosystems) for chain termination chemistry.[1] DNA was prepared for sequencing using a QUIAGEN Mini-prep kit. UV-Visible spectrophotometry was measured on a Lambda-series UV-Visible spectrophotometer equipped with a thermoelectric cuvette holder. Measurements were made in quartz cuvettes with a 1cm path length. Near UV circular dichronism (CD) was measured with an Aviv CD 202 spectrometer.

Substrate synthesis: (2R,3R)-β-phenylserine was synthesized in five steps from

cinnamic acid following published methods[2] (Scheme S1).

Methyl (2R,3R)-2-amino-3-hydroxy-3-phenylpropionate (3). A solution of 2[2] (370 mg, 1.67 mmol) in MeOH (10 ml) was treated with SnCl2.2H2O (756 mg, 3.35 mmol, 2.0 eqv.) and stirred for 2.5 h at room temperature. The solvent was removed under vacuum and the residue taken in H2O (10 ml), treated with 6 N NaOH (up to pH 10), and stirred for 20 min at room temperature before addition of EtOAc (10 ml).The organic layer was separated and the aqueous layers further extracted with EtOAc (3 x 10 ml). The combined organic extracts were dried over Na2SO4, filtered and the solvent evaporated to give 3 as a white solid (300 solvent evaporated to give 3 as a white solid (300 mg, 92 % yield). 1H NMR (CDCl3, 300 MHz) δ (ppm) 7.3-7.2 (m, 5H), 4.88 (d, J = 5.7 Hz, 1H), 3.74 (d, J = 5.7 Hz, 1H), 3.62 (s, 3H); 13C NMR (CDCl3, 75.0 MHz) δ (ppm) 173.3, 139.7, 128.2, 127.9, 126.2, 74.4, 60.1, 52.0; (in agreement with literature values reported for the meso-(2S,3S)-

isomer[3])

(2R,3R)-β-phenylserine (4). The methyl ester 3 (90 mg, 0.46 mmol) was dissolved in 4 ml of H2O/MeCN (1:1) and treated with LiOH (23 mg, 0.55 mg, 1.2 eqv.). The solution was stirred at room temperature for 2 h and lyophilized. The product was purified by HPLC to give 4 as a white solid (83 mg, quant.). [α]20

D -32.5 (c 0.83, 6 N

HCl); 1H NMR (D2O, 300 MHz) δ (ppm) 7.5-7.3 (m, 5H), 5.32 (d, J = 4.2 Hz, 1H),

4.18 (d, J = 4.2 Hz, 1H); 13C NMR (D2O, 75.0 MHz) δ (ppm) 169.9, 136.6, 128.7,

128.6, 126.0, 70.8, 59.5; m/z (ESI) 182 (MH+), 164 (MH+-H2O), 120 (MH+-H20-

CO2), 91 (PhCH2

+); (in agreement with literature values[4])

Mutagenesis: All mutations were introduced by standard overlap-extention PCR using the Bacillus stearothermophilus alanine racemase gene as template (for the single mutants), or the relevant mutant genes. The primers used were:

Adaptor primers:

Bs-ARf: TGATAACATATGAACGACTTTCATCGCGATACG

Bs-ARr: TACTCGAGTGCACTGCTTTCCCCGCGG

Mutagenesis primers:

M134Ff: ACCGGCTTTGGACGGCTTG

M134Fr: CCGTCCAAAGCCGGTGTCCA

Y265Sf: GTGAGCAGCGGTGCGACGT

Y265Sr: CGCACCGCTGCTCACCTTT

Y265Vf: GTGAGCGTGGGTGCGACGT

Y265Vr: CGCACCCACGCTCACCTTT

Y265Ef: GTGAGCGAAGGTGCGACGT

Y265Er: CGCACCTTCGCTCACCTTT

Y265Rf: GTGAGCCGTGGTGCGACGT

Y265Rr: CGCACCACGGCTCACCTTT

Y265Kf: GTGAGCAAAGGTGCGACGT

Y265Kr: CGCACCTTTGCTCACCTTT

I352Wf: GAAACGTGGAACTACGAAGTGC

I352Wr: GTAGTTCCACGTTTCCAAATGG

The PCR products were inserted into a pET22b modified plasmid, with a C-terminal His6-tag encoded. Calcium competent Escherichia coli BL21 cells were transformed with the engineered plasmids, and the recombinant proteins were expressed upon induction with 0.5mM IPTG and growth at 37ºC in LB medium. Cell lysis and purification on Ni-NTA resin (Quiagen) were performed using standard procedures. The purified proteins were characterized by CD spectrophotometry, SDS-PAGE gel electrophoresis and mass spectrometry. Protein concentration was determined by measuring the absorbance at 280 nm, using the calculated molar extinction coefficients: 46870 M-1 cm-1 (Y265A, Y265S, Y265V, Y265E, Y265R, Y265K, M134F/Y265K), and 52370 M-1 cm-1 (Y265K/I352W, M134F/Y265K/I352W). The proteins were stored at 4ºC.

Kinetic assays: All kinetic measurements were performed in 100 mM Hepes buffer, pH 8.0, at 30ºC. The assay mixture contained 10 μM pyridoxal 5’-phosphate. Initial rates were determined by monitoring the appearance of benzyldehyde spectrophotometrically at 279 nm (Δε279nm = 1400 M-1 cm-1), and were corrected for the background reaction.[5] Kinetic parameters kcat and Km were calculated from the initial rates using concentrations of β-phenylserine ranging between 5 and 160 mM (racemic threo-β-phenylserine; the Km values were calculated under the assumption that only the D-isomer is a substrate, therefore, the concentrations were halved), and between 0.7 and 14 mM (pure D-erythro-β-phenylserine) (Figures S1 and S2).

About The Researchers :

Prof. Dr. D. Hilvert
 
Laboratorium für Organische Chemie
 
ETH Hönggerberg, HCI
 
CH-8093 Zürich, Switzerland
 
Tel : +41-1-632 3176
 
Fax: +41-1-632 1486
 
e-mail: hilvert@org.chem.ethz.ch

Forschungsgruppe Prof. Dr. D. Hilvert

Prof. Hilvert (b. 1956) received his B.A. (1978) and Ph.D. (1983) from Brown and Columbia Universities, respectively. Following postdoctoral work at Rockefeller University, he joined the faculty of the Scripps Research Institute

Dr. Miguel Toscano
Laboratory of Organic Chemistry
HCI F336
ETH Hönggerberg
8093 Zurich
Switzerland

Phone: +41 44 633 4197
Fax: +41 44 632 1486

toscano@org.chem.ethz.ch

Manuel Müller
Laboratory of Organic Chemistry
HCI F328
ETH Hönggerberg
8093 Zurich
Switzerland

Phone: +41 44 632 2974
Fax: +41 44 632 1486

manuel.mueller@org.chem.ethz.ch

In the images:

Figure S1. Representative kinetic assays of the Y265K alanine racemase variant with

(2R,3S)- and (2R,3R)-β-phenylserine

References

[1] F. Sanger, J.E. Donelson, A.R. Coulson, H. Kossel, D. Fisher, Proc. Natl.

Acad. Sci. USA 1973, 70, 1209.

[2] H.C. Kolb, M.S. VanNieuwenhze, K.B. Sharpless, Chem. Rev. 1994, 94, 2483;

D.L. Boger, M.A. Patane, J.C. Zhou, J. Am. Chem. Soc. 1994, 116, 8544; H.

Hönig, P. Seufer-Wasserthal, H. Weber, Tetrahedron 1990, 46, 3841.

[3] Z.M. Adams, R.F.W. Jackson, N.J. Palmer, H.K. Rami, M.J. Wythes, J. Chem.

Soc., Perkin Trans. 1 1999, 937.

[4] F.A. Davis, V. Srirajan, D.L. Fanelli, P. Portonovo, J. Org. Chem. 2000, 65,

7663.

[5] F.P. Seebeck, D. Hilvert, J. Am. Chem. Soc. 2003, 125, 10158.


Tags: stereoselectivity - PLP-dependent aldolase - circular dichronism - Acros - circular dichronism -
Research Documents:
Related research: Discovery of a fundamental mechanism of plant morphogenesis, New Insight in Nanotechnology by Uncovering Conductive Property of Carbon-Based Molecules, UM Physicists Showed Electrons Can Travel More Than 100 Times Faster in Graphene, the Intrinsic Limit to the Mobility, University of Minnesota Researchers have Confirmed that Riboflavin be Key for Converting Waste to Electricity

Add Research

Full Name *
Email address *
Location
Your Research *

 
Home | Members.Benefit | Privacy.Policy | Bookmark.This.Page | Contact.Us
© 2006 - 2007 4engr. All Rights reserved

|Conveyor technology